MirGeneDB

MirGeneDB ID

Cin-Mir-4200

Family name MIR-4200 (all species)
Seed ACUAAAA
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4200
Paralogues
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
7: 6040512-6040567 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGAUUGGUUGGGAGUUAUUAAAUGUUCAACACUAAAAUGAGGGACAGAGAGAAACUAUUUUCCCUCUGUCCCUACUUUUAGUGCUGUCCGUUUUGUUCAGACGUACCACCCUGAA
Get precursor sequence
Structure
        10        20          30        40        50       
GUGAUUGGUUGGGAGUUAUU--|    UU  A        UG          A AAAC 
                      AAAUG  CA CACUAAAA  AGGGACAGAG G    U
                      UUUGC  GU GUGAUUUU  UCCCUGUCUC C    A
AAGUCCCACCAUGCAGACUUGU^    CU  C        CA          C UUUU 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4200_5p

MirBase accessionMIMAT0016819
Sequence
0- CACUAAAAUGAGGGACAGAGAG -22
Get sequence
Co-mature sequence

Cin-Mir-4200_3p

MirBase accessionMIMAT0016820
Sequence
34- CUCUGUCCCUACUUUUAGUGCU -56
Get sequence