MirGeneDB

Gene name

Cin-Mir-4179

Family name MIR-4179 (all species)
MiRBase ID cin-mir-4179b
Paralogues
Orthologues
Node of Origin (gene) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(Ciona_KH)
HT000184.1: 141827-141900 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCCUUAUUGAAAAUAAUCUCUUAGCAGUUUAUCUGGUAUAAAAAGUUUUGCCGGAUAGCAGACAAAAAGUCGGAAAUACAUUACGUUUUAUACCAGAUGAGCAGCUAAAGAAAUAUUUACAUUAUGCCUGGU
Get precursor sequence
Structure
        10           20        30        40        50        60      
UUUCCUUAUUGAAAAUAA---|  C     A                 A  UU  CCGGAUAGCAGAC 
                     UCU UUAGC GUUUAUCUGGUAUAAAA GU  UG             A
                     AGA AAUCG CGAGUAGACCAUAUUUU CA  AC             A
UGGUCCGUAUUACAUUUAUAA^  -     A                 G  UU  AUAAAGGCUGAAA 
  130       120        110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Star sequence

Cin-Mir-4179_5p*

MirBase accessionMIMAT0022335
Sequence
0- UUAUCUGGUAUAAAAAGUUUUG -22
Get sequence
Mature sequence

Cin-Mir-4179_3p

MirBase accessionMIMAT0022336
Sequence
52- UUACGUUUUAUACCAGAUGAGC -74
Get sequence
Seed sequenceUACGUUU