MirGeneDB

Gene name

Cin-Mir-4050

Family name MIR-4050 (all species)
MiRBase ID cin-mir-4050
Paralogues
Orthologues
Node of Origin (gene) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(Ciona_KH)
5: 3019437-3019494 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCUAAGAAUUUGUAAUAGUGGUUUGGCAUUAGGUAAAUCAAAUUUCAGGCUGUUAGUGAGACCAACAGCUUGAAUUUGUUGCCUACAGACACUCCACUGCUAUCUACUGAGGUUUCA
Get precursor sequence
Structure
        10          20        30        40        50          
AUCUAAGAAUUUGUAAU--|    UU  GCAU       AU      U         AGUG 
                   AGUGG  UG    UAGGUAA  CAAAUU CAGGCUGUU    \
                   UCACC  AC    AUCCGUU  GUUUAA GUUCGACAA    A
ACUUUGGAGUCAUCUAUCG^    UC  AGAC       --      -         CCAG 
      110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4050_5p

MirBase accessionMIMAT0016589
Sequence
0- UAGGUAAAUCAAAUUUCAGGCUGUU -25
Get sequence
Seed sequenceAGGUAAA
Star sequence

Cin-Mir-4050_3p*

MirBase accessionMIMAT0016590
Sequence
36- CAGCUUGAAUUUGUUGCCUACA -58
Get sequence