MirGeneDB

MirGeneDB ID

Cin-Mir-4031

Family name MIR-4031 (all species)
Seed CAUGUAC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4031
Paralogues
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
HT000052.1: 65613-65668 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGAUAGUGACGUCAUAAUGGUCUAAUGUCCCAAAGUGUCGGCGCAUAUUCUUAAAUAACCGAACAUGUACCGUCGCUCUGGGAUGCGCGACCAUUACUAUCAUCUGUGACGUAA
Get precursor sequence
Structure
        10          20        30        40        50       
GUGGAUAGUGACGUCAU--|      UAA       A    U   CG   A   UUAA 
                   AAUGGUC   UGUCCCA AGUG CGG  CAU UUC    A
                   UUACCAG   GUAGGGU UCGC GCC  GUA AAG    U
AAUGCAGUGUCUACUAUCA^      CGC       C    U   AU   C   CCAA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Star sequence

Cin-Mir-4031_5p*

MirBase accessionMIMAT0016551
Sequence
0- CCCAAAGUGUCGGCGCAUAUUC -22
Get sequence
Mature sequence

Cin-Mir-4031_3p

MirBase accessionMIMAT0016552
Sequence
34- ACAUGUACCGUCGCUCUGGGAU -56
Get sequence