MirGeneDB

Gene name

Cin-Mir-4013-P1

Family name MIR-4013 (all species)
MiRBase ID cin-mir-4013a
Paralogues Cin-Mir-4013-P2 
Orthologues
Node of Origin (gene) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(Ciona_KH)
HT000174.1: 447280-447335 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUUUGCAUUAAUUGGUCUACGUGAUUACAGACUUGUAAUAGCAGCAUGCGUCGGUUAAACCGUAGGCUGCUAAUGCAAGCCCGUAUUCACUGAAGAAAUAUCUGCCACGUAUAA
Get precursor sequence
Structure
        10         20         30        40        50       
UCUUUUGCAUUAAUUGG-   A -|   U   AGA      A       A    UCGG 
                  UCU C GUGA UAC   CUUGUA UAGCAGC UGCG    U
                  AGA G CACU AUG   GAACGU AUCGUCG AUGC    U
AAUAUGCACCGUCUAUAA   A U^   U   CCC      A       G    CAAA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4013-P1_5p

MirBase accessionMIMAT0016514
Sequence
0- AGACUUGUAAUAGCAGCAUGCG -22
Get sequence
Seed sequenceGACUUGU
Co-mature sequence

Cin-Mir-4013-P1_3p

MirBase accessionMIMAT0016515
Sequence
34- UAGGCUGCUAAUGCAAGCCCGU -56
Get sequence
Seed sequenceAGGCUGC