MirGeneDB

Gene name

Cin-Mir-4003-P2a

Family name MIR-4003 (all species)
MiRBase ID cin-mir-4003b
Paralogues Cin-Mir-4003-P1a  Cin-Mir-4003-P1b1  Cin-Mir-4003-P1b2  Cin-Mir-4003-P1c  Cin-Mir-4003-P1d  Cin-Mir-4003-P1e  Cin-Mir-4003-P2b  Cin-Mir-4003-P3 
Orthologues
Node of Origin (gene) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(Ciona_KH)
7: 4834859-4834917 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-4003-P2a)
Mir-4003-P1e 7: 4829677-4829736 [-] UCSC Ensembl
Mir-4077-P1 7: 4830534-4830591 [-] UCSC Ensembl
Mir-4003-P3 7: 4831240-4831296 [-] UCSC Ensembl
Mir-4003-P1a 7: 4832644-4832703 [-] UCSC Ensembl
Mir-4077-P4 7: 4833414-4833471 [-] UCSC Ensembl
Mir-4077-P2 7: 4835910-4835967 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCGAUGCAAUAUACGAAAAACUCGACGCAUGAGUUGGUUAUUCAAUCUUGCGAUAUUUAACAGUAGCAAGAUUGGUAACCAACACUAACGUCGUUUUUUACAAUCAUUCUUUUUAGUC
Get precursor sequence
Structure
        10          20        30        40        50         
GUCGAUGCAAUAUACGA--|   CU     CAUGA         U         GAUAUU 
                   AAAA  CGACG     GUUGGUUAU CAAUCUUGC      U
                   UUUU  GCUGC     CAACCAAUG GUUAGAACG      A
CUGAUUUUUCUUACUAACA^   UU     AAUCA         -         AUGACA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4003-P2a_5p

MirBase accessionMIMAT0016469
Sequence
0- UGAGUUGGUUAUUCAAUCUUGC -22
Get sequence
Seed sequenceGAGUUGG
Star sequence

Cin-Mir-4003-P2a_3p* (predicted)

MirBase accessionMIMAT0016470
Sequence
38- AAGAUUGGUAACCAACACUAA -59
Get sequence