MirGeneDB

MirGeneDB ID

Cin-Mir-4003-P1a

Family name MIR-4003 (all species)
Seed GAGUUGG
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4003a-1
Paralogues Cin-Mir-4003-P1b1  Cin-Mir-4003-P1b2  Cin-Mir-4003-P1c  Cin-Mir-4003-P1d  Cin-Mir-4003-P1e  Cin-Mir-4003-P2a  Cin-Mir-4003-P2b  Cin-Mir-4003-P3 
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
7: 4832644-4832703 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-4003-P1a)
Mir-4003-P1e 7: 4829677-4829736 [-] UCSC Ensembl
Mir-4077-P1 7: 4830534-4830591 [-] UCSC Ensembl
Mir-4003-P3 7: 4831240-4831296 [-] UCSC Ensembl
Mir-4003-P1a 7: 4832644-4832703 [-] UCSC Ensembl
Mir-4077-P4 7: 4833414-4833471 [-] UCSC Ensembl
Mir-4003-P2a 7: 4834859-4834917 [-] UCSC Ensembl
Mir-4077-P2 7: 4835910-4835967 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGUAAGUAAAAUGUACAAAAACUCAACGGUUGAGUUGGUUAUACAUUCUUGCGGUAUUAAAGUAACAGCAAGAAUUUUAACCAACACAGACGUCGGUUUUUACCGUCAGCCUAUUUUAUU
Get precursor sequence
Structure
        10           20        30        40        50          
CGUAAGUAAAAUGUACA---|     CA   G   A        UAC        GGUAUUA 
                    AAAACU  ACG UUG GUUGGUUA   AUUCUUGC       \
                    UUUUGG  UGC GAC CAACCAAU   UAAGAACG       A
UUAUUUUAUCCGACUGCCAU^     C-   A   A        UU-        ACAAUGA 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4003-P1a_5p

MirBase accessionMIMAT0016461
Sequence
0- UGAGUUGGUUAUACAUUCUUGCG -23
Get sequence
Co-mature sequence

Cin-Mir-4003-P1a_3p

MirBase accessionMIMAT0016462
Sequence
38- CAAGAAUUUUAACCAACACAGA -60
Get sequence