MirGeneDB

Gene name

Cin-Mir-126-v1

Family name MIR-126 (all species)
MiRBase ID cin-mir-126
Paralogues Cin-Mir-126-v2 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (gene) Olfactores
Node of Origin (family) Olfactores
Genome context
(Ciona_KH)
1: 5485228-5485289 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 1: 5485228-5485289 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUAAAGUGCCGUAACUGGUUUUCGAUGCUGCCUUGUUACCUACGGUACCAGGUAGAAAGUAUGUCAUCUCGUACCGUGAGUAAUAAAGCAUUCUCGGGAGCUCAAUGCAACCGGUACUAUA
Get precursor sequence
Structure
        10          20        30        40        50        60
UGUAAAGUGCCGUAACU--|   UU   UGC   C       C        C  GUAGAAA 
                   GGUU  CGA   UGC UUGUUAC UACGGUAC AG       G
                   UCGA  GCU   ACG AAUAAUG GUGCCAUG UC       U
AUAUCAUGGCCAACGUAAC^   GG   CUU   A       A        C  UACUGUA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Star sequence

Cin-Mir-126-v1_5p*

MirBase accessionMIMAT0015258
Sequence
0- GCCUUGUUACCUACGGUACCAG -22
Get sequence
Mature sequence

Cin-Mir-126-v1_3p

MirBase accessionMIMAT0006101
Sequence
40- CGUACCGUGAGUAAUAAAGCAU -62
Get sequence
Seed sequenceGUACCGU