MirGeneDB

Gene name

Cgi-Mir-67-P5

Family name MIR-67 (all species)
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-67-P4  Cgi-Mir-67-P6 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dan-Mir-67  Dme-Mir-67  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) C. gigas
Node of Origin (family) Protostomia
Genome context
(CGI_GCA_000297895.1)
scaffold226: 224596-224654 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAUGACCAUCAGAACUUGUAAAUCACGUGACCUUGUUCGGCCUGGUUGUUAUGUGGACAUGUGACAUCACAACCUGCAUGAAUGAGGGCAUGUGGUUCAAUUCUUUCGACGUAUUCCAU
Get precursor sequence
Structure
        10        20          30         40        50         
GAUGACCAUCAGAACUUGUA--         A   UG    -| CU      U   UGGAC 
                      AAUCACGUG CCU  UUCG GC  GGUUGU AUG     \
                      UUGGUGUAC GGA  AAGU CG  CCAACA UAC     A
UACCUUAUGCAGCUUUCUUAAC         G   GU    A^ U-      C   AGUGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-67-P5_5p*

MirBase accessionNone
Sequence
0- CCUUGUUCGGCCUGGUUGUUAUG -23
Get sequence
Mature sequence

Cgi-Mir-67-P5_3p

MirBase accessionNone
Sequence
36- UCACAACCUGCAUGAAUGAGGGC -59
Get sequence
Seed sequenceCACAACC