MirGeneDB

Gene name

Cbr-Mir-96-P2a

Family name MIR-96 (all species)
MiRBase ID cbr-mir-790-1
Paralogues Cbr-Mir-96-P2b  Cbr-Mir-96-P3 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bge-Mir-96-P2  Bta-Mir-96-P2  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
IV: 6048856-6048920 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P2a)
Mir-96-P3 IV: 6041106-6041167 [+] UCSC Ensembl
Mir-96-P2b IV: 6048235-6048292 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUAAGUUUUUUAAAAAGUCCCUUCCGAUUGCUUGGCACUCGCGAACACCGCGAUCACUUCCAAUAUCGAUCCGCGGAGUUAGCCAGUGUCAACCAAAUGGAUGUUUGAGACUUGUCAUUCUUAAA
Get precursor sequence
Structure
        10        20          30        40        50        60  
GUAAGUUUUUUAAAAAGUCCCU--|   A   C        C  G   A     AUCACUUCC 
                        UCCG UUG UUGGCACU GC AAC CCGCG         \
                        AGGU AAC AACUGUGA CG UUG GGCGC         A
AAAUUCUUACUGUUCAGAGUUUGU^   A   C        C  A   A     CUAGCUAUA 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-96-P2a_5p

MirBase accessionMIMAT0004292
Sequence
0- CUUGGCACUCGCGAACACCGCG -22
Get sequence
Seed sequenceUUGGCAC
Star sequence

Cbr-Mir-96-P2a_3p*

MirBase accessionNone
Sequence
43- CGGAGUUAGCCAGUGUCAACCA -65
Get sequence