MirGeneDB

Gene name

Cbr-Mir-785-P1

Family name MIR-785 (all species)
MiRBase ID cbr-mir-785a
Paralogues Cbr-Mir-785-P2 
Orthologues Cel-Mir-785 
Node of Origin (gene) C. briggsae
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
X: 8055330-8055397 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-785-P1)
Mir-249 X: 8056761-8056824 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGAAAUGCGUUGCUCUUUCGCAACCGUCAGCACAGAGUGCUUCGACUUACACAGAAUUCGUAAAACCAACUGAUGUAAGUGAAUACUCUGUGUUGAUGGUGAUGAUGCUGAAACGUAAUGUAUUCU
Get precursor sequence
Structure
        10          20        30        40        50        60    
UUUGAAAUGCGUUGCUCUU--|  CA                 C   G       CAGAAUUCGU 
                     UCG  ACCGUCAGCACAGAGUG UUC ACUUACA          A
                     AGU  UGGUAGUUGUGUCUCAU AAG UGAAUGU          A
UCUUAUGUAAUGCAAAGUCGU^  AG                 -   -       AGUCAACCAA 
      120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Star sequence

Cbr-Mir-785-P1_5p*

MirBase accessionNone
Sequence
0- AGCACAGAGUGCUUCGACUUACA -23
Get sequence
Mature sequence

Cbr-Mir-785-P1_3p

MirBase accessionMIMAT0004286
Sequence
47- UAAGUGAAUACUCUGUGUUGA -68
Get sequence
Seed sequenceAAGUGAA