MirGeneDB

Gene name

Cbr-Mir-784

Family name MIR-784 (all species)
MiRBase ID cbr-mir-784
Paralogues
Orthologues Cel-Mir-784 
Node of Origin (gene) Caenorhabditis
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
X: 13857300-13857362 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGAUCCAUUCCUCAAUUUGUACUACCAAGUGGCACAAUACCUGUAUGUAGAUAGUGAAGUAAUAUUGUUCUACAUACACCUAUUGAGCCACCUGGUGGAUUCGCAAAACUCUUUGAUGUCUA
Get precursor sequence
Structure
        10        20          30        40        50        60 
CGGAUCCAUUCCUCAAUUUGUA--|     A     A     CC          UAGUGAAG 
                        CUACCA GUGGC CAAUA  UGUAUGUAGA        \
                        GGUGGU CACCG GUUAU  ACAUACAUCU        U
AUCUGUAGUUUCUCAAAACGCUUA^     C     A     CC          UGUUAUAA 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-784_5p

MirBase accessionMIMAT0004285
Sequence
0- UGGCACAAUACCUGUAUGUAGA -22
Get sequence
Seed sequenceGGCACAA
Star sequence

Cbr-Mir-784_3p*

MirBase accessionNone
Sequence
41- UACAUACACCUAUUGAGCCACC -63
Get sequence