MirGeneDB

Gene name

Cbr-Mir-7589

Family name MIR-7589 (all species)
MiRBase ID cbr-mir-7589
Paralogues
Orthologues
Node of Origin (gene) C. briggsae
Node of Origin (family) C. briggsae
Genome context
(CB4)
X: 2057130-2057193 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUAAGAAGAAGCACGCCGAUGAUGCAAAGGUAAGAUUCCUUCAUUUCAUCCAAAAAGUUGGUUGAAUUAUUUGGAAAUGGAGAAAUCUUACAGGCCCAGACAGCGCUCGUCAGCUCCGUUCUC
Get precursor sequence
Structure
        10        20            30        40        50        60   
GCUAAGAAGAAGCACGCCGAUGAU----| AAAG        C       UCA      AAGUUGG 
                            GC    GUAAGAUU CUUCAUU   UCCAAA       \
                            CG    CAUUCUAA GAGGUAA   AGGUUU       U
CUCUUGCCUCGACUGCUCGCGACAGACC^ GA--        A       ---      AUUAAGU 
  120       110       100          90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
20 Cb Ea Yo
Star sequence

Cbr-Mir-7589_5p*

MirBase accessionNone
Sequence
0- GUAAGAUUCCUUCAUUUCAUCCAAA -25
Get sequence
Mature sequence

Cbr-Mir-7589_3p

MirBase accessionMIMAT0029595
Sequence
42- UGGAAAUGGAGAAAUCUUACAG -64
Get sequence
Seed sequenceGGAAAUG