MirGeneDB

Gene name

Cbr-Mir-7583-P4

Family name MIR-7583 (all species)
MiRBase ID cbr-mir-7583d
Paralogues Cbr-Mir-7583-P1  Cbr-Mir-7583-P2  Cbr-Mir-7583-P3  Cbr-Mir-7583-P5 
Orthologues
Node of Origin (gene) C. briggsae
Node of Origin (family) C. briggsae
Genome context
(CB4)
X: 20312033-20312090 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUUAUCUACUUGAUGAACACAACGUCGUCAGUUGCAAAUAUCGUGGUGGCAUUACAUGUUGUCUUGCCAUCCGUCAUUUGUGGUUGACGAUGUAUCAUGUACAUCAGAAGAAGUUCU
Get precursor sequence
Structure
        10        20          30        40        50         
CUUUAUCUACUUGAUGAACACA--|         UU      AU  U       UUACAU 
                        ACGUCGUCAG  GCAAAU  CG GGUGGCA      \
                        UGUAGCAGUU  UGUUUA  GC CUACCGU      G
UCUUGAAGAAGACUACAUGUACUA^         GG      CU  -       UCUGUU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-7583-P4_5p

MirBase accessionMIMAT0029591
Sequence
0- AGUUGCAAAUAUCGUGGUGGCA -22
Get sequence
Seed sequenceGUUGCAA
Star sequence

Cbr-Mir-7583-P4_3p*

MirBase accessionNone
Sequence
37- CCAUCCGUCAUUUGUGGUUGA -58
Get sequence