MirGeneDB

Gene name

Cbr-Mir-65-P5

Family name MIR-65 (all species)
MiRBase ID cbr-mir-64b
Paralogues Cbr-Mir-65-P1  Cbr-Mir-65-P4  Cbr-Mir-65-P6 
Orthologues
Node of Origin (gene) C. briggsae
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
III: 869105-869166 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-65-P5)
Mir-65-P1 III: 868825-868890 [-] UCSC Ensembl
Mir-65-P4 III: 869227-869290 [-] UCSC Ensembl
Mir-65-P6 III: 869360-869420 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCGUUAUUCUUUCCGAAGGCCCCGCCUUCCAUGACACCCAAGCGUGUCUGGAAUGACAGAAUGGUCCUCCGGACCGCUGAUGUGGCAUGAACGGCGGGAGUUGGUCCCUAAAAGGACAGGU
Get precursor sequence
Structure
        10         20         30        40        50        60 
UCCGUUAUUCUUUCCGAA-   -|     UUC    A   CCA    U       AUGACAG 
                   GGC CCCGCC   CAUG CAC   AGCG GUCUGGA       \
                   UUG GGGCGG   GUAC GUG   UCGC CAGGCCU       A
UGGACAGGAAAAUCCCUGG   A^     CAA    G   UAG    -       CCUGGUA 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-65-P5_5p

MirBase accessionNone
Sequence
0- CAUGACACCCAAGCGUGUCUGGA -23
Get sequence
Seed sequenceAUGACAC
Star sequence

Cbr-Mir-65-P5_3p*

MirBase accessionMIMAT0011490
Sequence
40- CGGACCGCUGAUGUGGCAUGAA -62
Get sequence