MirGeneDB

MirGeneDB ID

Cbr-Mir-252-P2

Family name MIR-252 (all species)
Seed UAAGUAG
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-251
Paralogues Cbr-Mir-252-P1 
Orthologues Asu-Mir-252-P2  Bfl-Mir-252-P2  Bge-Mir-252-P2  Cel-Mir-252-P2  Cgi-Mir-252-P2  Cte-Mir-252-P2  Dan-Mir-252-P2  Dme-Mir-252-P2  Dmo-Mir-252-P2  Dpu-Mir-252-P2  Hme-Mir-252-P2  Isc-Mir-252-P2  Lan-Mir-252-P2a  Lan-Mir-252-P2b  Lgi-Mir-252-P2  Pfl-Mir-252-P2  Pmi-Mir-252-P2  Sko-Mir-252-P2  Spu-Mir-252-P2  Tca-Mir-252-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
X: 5784611-5784672 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUAUACUGUUUUGUCCCAAAUGACAUCUCGUUAAGUAGUGGUGCCGCUCUUAUUAGAAUUAUCAAGUAAUAAGAGUUGUUCGCUACUUAACGAGAGGAAAUUUGGAAAGAUGUGUCAGUUGU
Get precursor sequence
Structure
        10          20        30        40        50        60 
CUAUACUGUUUUGUCCC--|   GACA                U  C         AGAAUU 
                   AAAU    UCUCGUUAAGUAGUGG GC GCUCUUAUU      \
                   UUUA    AGAGCAAUUCAUCGCU UG UGAGAAUAA      A
UGUUGACUGUGUAGAAAGG^   AAGG                -  U         UGAACU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Mature sequence

Cbr-Mir-252-P2_5p

MirBase accessionMIMAT0000506
Sequence
0- UUAAGUAGUGGUGCCGCUCUUAUU -24
Get sequence
Star sequence

Cbr-Mir-252-P2_3p*

MirBase accessionNone
Sequence
39- UAAGAGUUGUUCGCUACUUAACG -62
Get sequence