MirGeneDB

Gene name

Cbr-Mir-252-P1

Family name MIR-252 (all species)
MiRBase ID cbr-mir-252
Paralogues Cbr-Mir-252-P2 
Orthologues Aae-Mir-252-P1-v1  Bfl-Mir-252-P1  Bge-Mir-252-P1-v1  Bge-Mir-252-P1-v2  Cel-Mir-252-P1  Cgi-Mir-252-P1  Cte-Mir-252-P1  Dan-Mir-252-P1-v1  Dan-Mir-252-P1-v2  Dme-Mir-252-P1-v1  Dme-Mir-252-P1-v2  Dmo-Mir-252-P1-v1  Dmo-Mir-252-P1-v2  Dpu-Mir-252-P1-v1  Dpu-Mir-252-P1-v2  Hme-Mir-252-P1-v1  Isc-Mir-252-P1-v1  Isc-Mir-252-P1-v2  Lan-Mir-252-P1a  Lan-Mir-252-P1b  Lgi-Mir-252-P1  Pfl-Mir-252-P1  Pmi-Mir-252-P1  Sko-Mir-252-P1  Spu-Mir-252-P1  Tca-Mir-252-P1-v1 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
II: 8309594-8309659 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCCUAUUCCAACCGAGGUCUCUCCCAGUUAUAAGUAGUAGUGCCGCAGGUAACCGCUUCCAGAAAAUUGGUUUACCUACUGCCUUCUGCUUAGAAUUGGGAUUUUGAUGACCGUCUAUAAUAAUA
Get precursor sequence
Structure
        10        20          30        40        50        60   
UUCCUAUUCCAACCGAGGUCUC--|       A       U  U  CGC      CCGCUUCCA 
                        UCCCAGUU UAAGUAG AG GC   AGGUAA         \
                        AGGGUUAA AUUCGUC UC CG   UCCAUU         G
AUAAUAAUAUCUGCCAGUAGUUUU^       G       U  -  UCA      UGGUUAAAA 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-252-P1_5p

MirBase accessionMIMAT0000507
Sequence
0- AUAAGUAGUAGUGCCGCAGGUAA -23
Get sequence
Seed sequenceUAAGUAG
Star sequence

Cbr-Mir-252-P1_3p*

MirBase accessionNone
Sequence
44- ACCUACUGCCUUCUGCUUAGAA -66
Get sequence