MirGeneDB

Gene name

Cbr-Mir-2222-P1a

Family name MIR-2222 (all species)
MiRBase ID cbr-mir-2222-1
Paralogues Cbr-Mir-2222-P1b  Cbr-Mir-2222-P2a  Cbr-Mir-2222-P2b 
Orthologues
Node of Origin (gene) C. briggsae
Node of Origin (family) C. briggsae
Genome context
(CB4)
X: 20535807-20535870 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2222-P1a)
Mir-7587 X: 20533902-20533963 [+] UCSC Ensembl
Mir-2222-P1b X: 20537178-20537241 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUGAAUGGUCAGGUUACCAGUCGACCUGUGCUGCCUCUUUCUUUCGUGAUAUUUUUCACAGCGUAAAAAUAUCACAAGAACAGAUCCAGCACUGCUGCCUCUUUCUUUCGUGAUAUUUUUCACAGCGUAAAAAUAUCACAAGAACAGAUCCAGCACAGGUCGUUUACCUGACAUUUAUUCUGCUAU
Get precursor sequence
Structure
        10        20         30        40        50        60  
UCAUGAAUGGUCAGGUUACCAGU-|     GUGCUGCCUCUUUCUUUCGUGAUAUUUUUCAC 
                        CGACCU                                \
                        GCUGGA                                A
UAUCGUCUUAUUUACAGUCCAUUU^     CACGACCUAGACAAGAACACUAUAAAAAUGCG 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-2222-P1a_5p

MirBase accessionMIMAT0011487
Sequence
41- UAUCACAAGAACAGAUCCAGCAC -64
Get sequence
Seed sequenceAUCACAA
Star sequence

Cbr-Mir-2222-P1a_3p*

MirBase accessionNone
Sequence
0- UGCUGCCUCUUUCUUUCGUGAUAUU -25
Get sequence