MirGeneDB

MirGeneDB ID

Cbr-Mir-190

Family name MIR-190 (all species)
Seed GAUAUGU
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-50
Paralogues
Orthologues Aae-Mir-190  Aca-Mir-190-P1  Aca-Mir-190-P2  Ami-Mir-190-P1  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P1  Bta-Mir-190-P2  Cel-Mir-190  Cfa-Mir-190-P1  Cfa-Mir-190-P2  Cgi-Mir-190  Cli-Mir-190-P1  Cpi-Mir-190-P1  Cpi-Mir-190-P2  Cpo-Mir-190-P1  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P1  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P1  Dre-Mir-190-P2  Efe-Mir-190-P3  Efe-Mir-190-P4  Efe-Mir-190-P5  Efe-Mir-190-P6  Ete-Mir-190-P1  Ete-Mir-190-P2  Gga-Mir-190-P1  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P1  Hsa-Mir-190-P2  Isc-Mir-190  Lan-Mir-190-P7  Lan-Mir-190-P8  Lgi-Mir-190-v1  Lgi-Mir-190-v2  Mdo-Mir-190-P1  Mdo-Mir-190-P2  Mml-Mir-190-P1  Mml-Mir-190-P2  Mmu-Mir-190-P1  Mmu-Mir-190-P2  Oan-Mir-190-P1  Oan-Mir-190-P2  Ocu-Mir-190-P1  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P1a  Rno-Mir-190-P1b  Rno-Mir-190-P2  Sha-Mir-190-P1  Sha-Mir-190-P2  Sko-Mir-190  Sto-Mir-190-P1  Sto-Mir-190-P2  Tca-Mir-190  Tgu-Mir-190-P1  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
I: 2597966-2598032 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUCAGUAUUCCUUCCACCCACCGGCCGCUGAUAUGUCUGAUAUUCUUGGGUUAUCUGAUAAUGAUUGUUGUAACUCAAGUAUUAGACGUAUCGACGGCCGGCUGGGUUGGAAUCAUUAUUAUUUA
Get precursor sequence
Structure
        10         20         30        40        50        60    
UAAUCAGUAUUCCUUCC-     -|      C              UU        AUCUGAUAA 
                  ACCCA CCGGCCG UGAUAUGUCUGAUA  CUUGGGUU         \
                  UGGGU GGCCGGC GCUAUGCAGAUUAU  GAACUCAA         U
AUUUAUUAUUACUAAGGU     C^      A              --        UGUUGUUAG 
     120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Mature sequence

Cbr-Mir-190_5p

MirBase accessionMIMAT0000475
Sequence
0- UGAUAUGUCUGAUAUUCUUGGGUU -24
Get sequence
Star sequence

Cbr-Mir-190_3p*

MirBase accessionNone
Sequence
45- CUCAAGUAUUAGACGUAUCGAC -67
Get sequence