MirGeneDB

Gene name

Cbr-Let-7-P15

Family name LET-7 (all species)
MiRBase ID cbr-let-7
Paralogues Cbr-Let-7-P16  Cbr-Let-7-P17  Cbr-Let-7-P18 
Orthologues Aae-Let-7  Asu-Let-7-P15  Bge-Let-7  Cel-Let-7-P15  Cgi-Let-7  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7 
Node of Origin (gene) Chromadorea
Node of Origin (family) Bilateria
Genome context
(CB4)
X: 18534133-18534197 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGAUGAUGGCUCUACACUGGGGUACGGUGAGGUAGUAGGUUGUAUAGUUUAGAAUAUUACUCUCGGUGAACUAUGCAAGUUUCUACCUCACCGAAUACCAGGUUCUCAACUGCAUCGUGUCA
Get precursor sequence
Structure
        10          20        30        40        50        60  
GCAGGAUGAUGGCUCUACA--|   GG A           U  G          UAGAAUAUU 
                     CUGG  U CGGUGAGGUAG AG UUGUAUAGUU         \
                     GACC  A GCCACUCCAUC UU AACGUAUCAA         A
ACUGUGCUACGUCAACUCUUG^   AU A           U  G          GUGGCUCUC 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Let-7-P15_5p

MirBase accessionMIMAT0000463
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Seed sequenceGAGGUAG
Star sequence

Cbr-Let-7-P15_3p*

MirBase accessionNone
Sequence
43- CUAUGCAAGUUUCUACCUCACC -65
Get sequence