MirGeneDB

Gene name

Bta-Mir-29-P1b

Family name MIR-29 (all species)
Species Cow (Bos taurus)
MiRBase ID bta-mir-29c
Paralogues Bta-Mir-29-P1a  Bta-Mir-29-P2a  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr16: 77478610-77478667 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b5 chr16: 77478043-77478106 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCACCGGACCCAUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGAAAAGCAGCAGCCUCAAG
Get precursor sequence
Structure
        10            20         30        40        50         
CACCACCGGACCCAUCU----      -| GGC           UCC       C   GUCUG 
                     CUUACA CA   UGACCGAUUUC   UGGUGUU AGA     \
                     GGAUGU GU   AUUGGCUAAAG   ACCACGA UCU     U
GAACUCCGACGACGAAAAGGG      A^ ---           UUU       -   GUUUU 
      110       100        90           80        70         60
Deep sequencing
Go to detailed chart
CommentThere are Drosha sites -1 and -2 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-29-P1b_5p*

MirBase accessionNone
Sequence
0- ACCGAUUUCUCCUGGUGUUCAGA -23
Get sequence
Mature sequence

Bta-Mir-29-P1b_3p

MirBase accessionMIMAT0003829
Sequence
36- UAGCACCAUUUGAAAUCGGUUA -58
Get sequence
Seed sequenceAGCACCA
Validated targets TargetScanVert: bta-miR-29c