MirGeneDB

Gene name

Bta-Mir-126-v1

Family name MIR-126 (all species)
Species Cow (Bos taurus)
MiRBase ID bta-mir-126
Paralogues Bta-Mir-126-v2  Bta-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(bosTau8)
chr11: 104131417-104131475 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 chr11: 104131417-104131475 [+] UCSC Ensembl
Mir-126-v3 chr11: 104131417-104131475 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGACACAGCACCUCUGCUGGUGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUCAGCAGCCCGGCACGGAGCGCGCCCG
Get precursor sequence
Structure
        10          20        30        40        50         
GGAGACACAGCACCUCU--|   G      GA           U       CGCUGUGAC 
                   GCUG UGACGG  CAUUAUUACUU UGGUACG         \
                   CGAC ACUGUC  GUAAUAAUGAG GCCAUGC         A
GCCCGCGCGAGGCACGGCC^   G      GC           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-126-v1_5p

MirBase accessionMIMAT0004328
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Validated targets TargetScanVert: bta-miR-126-5p
Star sequence

Bta-Mir-126-v1_3p*

MirBase accessionMIMAT0003540
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Validated targets TargetScanVert: bta-miR-126-3p