MirGeneDB

Gene name

Bge-Novel-21

Family name BGE-NOVEL-21 (all species)
MiRBase ID
Paralogues
Orthologues
Node of Origin (gene) B. germanica
Node of Origin (family) B. germanica
Genome context
(Bger_2.0)
KZ614999.1: 53381-53441 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAGGGAAGGUGAUAUGCACUAUUGGUGAAUGGUAGUGACUUCCCAAGUGAUGUUACAUUCUAAAUUCAUCACUGGAAAGGCAAUAUCAUUAGCUACAAGUGAGAAGCAACAAACUAAGAU
Get precursor sequence
Structure
        10          20        30        40        50        60
AAAGGGAAGGUGAUAUG--|   AU    G       G  A   C   A      UUACAU 
                   CACU  UGGU AAUGGUA UG CUU CCA GUGAUG      U
                   GUGA  AUCG UUACUAU AC GAA GGU CACUAC      C
UAGAAUCAAACAACGAAGA^   AC    A       A  G   A   -      UUAAAU 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Novel-21_5p*

MirBase accessionNone
Sequence
0- UGGUAGUGACUUCCCAAGUGAUG -23
Get sequence
Mature sequence

Bge-Novel-21_3p

MirBase accessionNone
Sequence
39- UCACUGGAAAGGCAAUAUCAUU -61
Get sequence
Seed sequenceCACUGGA