MirGeneDB

Gene name

Bge-Mir-9-o17

Family name MIR-9 (all species)
MiRBase ID
Paralogues Bge-Mir-9-o18-v1  Bge-Mir-9-o18-v2  Bge-Mir-9-o19  Bge-Mir-9-o20 
Orthologues Cin-Mir-9  Cte-Mir-9  Hme-Mir-9-o17  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (gene) B. germanica
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ614731.1: 666805-666865 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAAAUAGAAGAUGGUGCUGUUGUCCUCUCUUUGGUGAUCUAGCUGUAUGAGUGUAAAACGACAUCAUAAAGCUAGAUUACCGAAGUCAGGAAAACAGUAUAUUCAACUGAUUUACUUU
Get precursor sequence
Structure
        10          20        30        40        50          
AGAAAAAUAGAAGAUGG--|      G    CU                G     GUGUAA 
                   UGCUGUU UCCU  CUUUGGUGAUCUAGCU UAUGA      \
                   AUGACAA AGGA  GAAGCCAUUAGAUCGA AUACU      A
UUUCAUUUAGUCAACUUAU^      A    CU                A     ACAGCA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-9-o17_5p

MirBase accessionNone
Sequence
0- UCUUUGGUGAUCUAGCUGUAUGA -23
Get sequence
Seed sequenceCUUUGGU
Star sequence

Bge-Mir-9-o17_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUAGAUUACCGAAGUCA -61
Get sequence