MirGeneDB

Gene name

Bge-Mir-87-o23

Family name MIR-87 (all species)
MiRBase ID
Paralogues Bge-Mir-87-o22  Bge-Mir-87-o24 
Orthologues Aae-Mir-87  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (gene) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ615904.1: 366017-366074 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCAACAUUUUCACGAGAGUUCCCCUCAUCGCCUGAUACUUGCUUUAACCUGAGUAUUUGACAAGGUGAGCAAAGUUUCAGGUGUGUGGGUGGAGCGGAGUUUCGCUCAAUCAUCGC
Get precursor sequence
Structure
        10          20        30         40         50        
CUUCAACAUUUUCACGAGA--     C     -       U  -|     UA    GAGUA 
                     GUUCC CUCAU CGCCUGA AC UUGCUU  ACCU     U
                     CGAGG GGGUG GUGGACU UG AACGAG  UGGA     U
CGCUACUAACUCGCUUUGAGG     U     U       U  A^     --    ACAGU 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-87-o23_5p*

MirBase accessionNone
Sequence
0- CGCCUGAUACUUGCUUUAACCU -22
Get sequence
Mature sequence

Bge-Mir-87-o23_3p

MirBase accessionNone
Sequence
36- GUGAGCAAAGUUUCAGGUGUGU -58
Get sequence
Seed sequenceUGAGCAA