
MirGeneDB ID


Family name MIR-87 (all species)
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-87-o22  Bge-Mir-87-o24 
Orthologues Aae-Mir-87  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (locus) B. germanica
Node of Origin (family) Protostomia
Genome context
KZ615904.1: 366017-366074 [-] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30         40         50        
CUUCAACAUUUUCACGAGA--     C     -       U  -|     UA    GAGUA 
                     GUUCC CUCAU CGCCUGA AC UUGCUU  ACCU     U
                     CGAGG GGGUG GUGGACU UG AACGAG  UGGA     U
CGCUACUAACUCGCUUUGAGG     U     U       U  A^     --    ACAGU 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionNone
Get sequence