MirGeneDB

Gene name

Bge-Mir-2-o66-v1

Family name MIR-2 (all species)
MiRBase ID
Paralogues Bge-Mir-2-o66-v2  Bge-Mir-2-o67-v1  Bge-Mir-2-o67-v2  Bge-Mir-2-o68-v1  Bge-Mir-2-o68-v2  Bge-Mir-2-o69  Bge-Mir-2-o70  Bge-Mir-2-P7 
Orthologues
Node of Origin (gene) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ615436.1: 350982-351043 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGAUAGUUCGGAGAUUAUGAUCUCAUUGCCCUCGUCAGAGUGGUUAUGAUGUGUCUAUAUUAAUUUCAUAUCACAGCCAGCUUUGAUGAGCGCAAAGGGAUUCUAAACACCUUUUAAGAAAA
Get precursor sequence
Structure
        10          20        30        40         50          
UGAUAGUUCGGAGAUUAU--      A    C          -|    A       UCUAUA 
                    GAUCUC UUGC CUCGUCAGAG UGGUU UGAUGUG      \
                    UUAGGG AACG GAGUAGUUUC ACCGA ACUAUAC      U
AAAAGAAUUUUCCACAAAUC      A    C          G^    C       UUUAAU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-2-o66-v1_5p*

MirBase accessionNone
Sequence
0- CUCGUCAGAGUGGUUAUGAUGUG -23
Get sequence
Mature sequence

Bge-Mir-2-o66-v1_3p

MirBase accessionNone
Sequence
38- UAUCACAGCCAGCUUUGAUGAGCG -62
Get sequence
Seed sequenceAUCACAG