MirGeneDB

Gene name

Bfl-Mir-216-P1

Family name MIR-216 (all species)
MiRBase ID bfl-mir-216
Paralogues
Orthologues Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(BFL_v2.0)
Bf_V2_29: 961718-961778 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-217 Bf_V2_29: 960805-960862 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UGUGGGUGUGGCCCUGUAUGGAUGGUUGUGUAAUCUCAGCUGGCAACUGUGAGUCUAACUUCACAUCCUCACGGUGCAAGCUGGGAUCGCUCAAACUUCUCAACUCUGCUUCAGUCCUUUU
Get precursor sequence
Structure
        10         20         30        40        50        60
UGUGGGUGUGGCCCUGUA-   AU    GU-|UA         G   A       UCUAAC 
                   UGG  GGUU   G  AUCUCAGCU GCA CUGUGAG      U
                   ACU  UCAA   C  UAGGGUCGA CGU GGCACUC      U
UUUUCCUGACUUCGUCUCA   CU    ACU^GC         A   -       CUACAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Bfl-Mir-216-P1_5p

MirBase accessionMIMAT0009495
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Co-mature sequence

Bfl-Mir-216-P1_3p

MirBase accessionMIMAT0019150
Sequence
39- CACGGUGCAAGCUGGGAUCGCU -61
Get sequence
Seed sequenceACGGUGC