MirGeneDB

MirGeneDB ID

Asu-Novel-8

Family name ASU-NOVEL-8 (all species)
Seed ACAGUCU
Species Large roundworm (Ascaris suum)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold656: 229799-229855 [+]
Precursor
(pre-Mir +30nt flank)
CUGGCCGGUAAGGUGAAGUUCAGUCCGCUGUACAGUCUCGAGGACGAACUAUGUGCAGGAGGACAUUUUCAUCCUCGAGACUGUGCAACGAACUGAACUUGUUUCCUUUGACAGAAU
Get precursor sequence
Structure
        10          20        30        40        50        
CUGGCCGGUAAGGUGAA--|      C  C                C   CU   UGCA 
                   GUUCAGU CG UGUACAGUCUCGAGGA GAA  AUG    G
                   CAAGUCA GC ACGUGUCAGAGCUCCU CUU  UAC    G
UAAGACAGUUUCCUUUGUU^      A  A                A   U-   AGGA 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Novel-8_5p

MirBase accessionNone
Sequence
0- UACAGUCUCGAGGACGAACUAUG -23
Get sequence
Star sequence

Asu-Novel-8_3p*

MirBase accessionNone
Sequence
35- UUUUCAUCCUCGAGACUGUGCA -57
Get sequence