MirGeneDB

MirGeneDB ID

Asu-Novel-7

Family name ASU-NOVEL-7 (all species)
Seed GGGGUAC
Species Large roundworm (Ascaris suum)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold614: 10332-10387 [-]
Precursor
(pre-Mir +30nt flank)
GAACUGUUGCAUUUAAUCGCGGUUCGCAAGCGGGGUACCAUCGUUCUAUGCAGUAGUGCCGGUGCAUAGAACGAUGGUAGCCCACUUGCGAACCGCUGAGCUCAUGCACCACACUG
Get precursor sequence
Structure
        10          20        30        40        50       
GAACUGUUGCAUUUAAUC--|           C   G                 GUAG 
                    GCGGUUCGCAAG GGG UACCAUCGUUCUAUGCA    U
                    CGCCAAGCGUUC CCC AUGGUAGCAAGAUACGU    G
GUCACACCACGUACUCGAGU^           A   G                 GGCC 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Novel-7_5p

MirBase accessionNone
Sequence
0- CGGGGUACCAUCGUUCUAUGCA -22
Get sequence
Star sequence

Asu-Novel-7_3p*

MirBase accessionNone
Sequence
34- CAUAGAACGAUGGUAGCCCACU -56
Get sequence