MirGeneDB

MirGeneDB ID

Asu-Novel-3

Family name ASU-NOVEL-3 (all species)
Seed UUUGAUC
Species Large roundworm (Ascaris suum)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold142: 201065-201123 [-]
Precursor
(pre-Mir +30nt flank)
UCAUUUUGAUCUCUAUUUUGACCUAUUUUCAUUUGAUCGAUCUUCAUUCUGAUAAAAGUGAAAAUCAAAAUGAAGACUGUUCAAAAUGAAAAUAGAUCAAAACGAAAGUAGAUGAAAAC
Get precursor sequence
Structure
        10          20        30         40        50        
UCAUUUUGAUCUCUAUU--    C         -|    U  A        C   UAAAA 
                   UUGA CUAUUUUCA UUUGA CG UCUUCAUU UGA     G
                   AACU GAUAAAAGU AAACU GU AGAAGUAA ACU     U
CAAAAGUAGAUGAAAGCAA    A         A^    U  C        A   AAAAG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Novel-3_5p

MirBase accessionNone
Sequence
0- AUUUGAUCGAUCUUCAUUCUGA -22
Get sequence
Co-mature sequence

Asu-Novel-3_3p

MirBase accessionNone
Sequence
36- AAAAUGAAGACUGUUCAAAAUGA -59
Get sequence