MirGeneDB

MirGeneDB ID

Asu-Novel-2

Family name ASU-NOVEL-2 (all species)
Seed CUUCGAC
Species Large roundworm (Ascaris suum)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold122: 2002114-2002167 [+]
Precursor
(pre-Mir +30nt flank)
UGCGCAUUCUGGCAGCACCUCGCGAGGUGUUCUUCGACAGUAUGGCCAAAGCUGGAAACAAGCUGCAGCCGGCUGUCGAAAAAUACCUAGGAGGCUUUUUACAAAGCGCUGUAG
Get precursor sequence
Structure
        10           20        30        40        50       
UGCGCAUUCUGGCAGCA---|   GCG       C         A    CAA    GGA 
                    CCUC   AGGUGUU UUCGACAGU UGGC   AGCU   \
                    GGAG   UCCAUAA AAGCUGUCG GCCG   UCGA   A
GAUGUCGCGAAACAUUUUUC^   GA-       A         -    ACG    ACA 
  110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Novel-2_5p

MirBase accessionNone
Sequence
0- UCUUCGACAGUAUGGCCAAAGCU -23
Get sequence
Star sequence

Asu-Novel-2_3p*

MirBase accessionNone
Sequence
33- UGCAGCCGGCUGUCGAAAAAU -54
Get sequence