MirGeneDB

MirGeneDB ID

Asu-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-228
Paralogues
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold583: 166177-166237 [-]
Precursor
(pre-Mir +30nt flank)
GAUGUGCGUUGCGGUUGCUCGCGUACACUCAAUGGCACUAGAUGAAUUCACGGUCCUUUUUGCUGUUCCGUGUAUUCACCAGUUCCAUAGAGUUGCGUUGGCUAUGCUGACAACUACUUUU
Get precursor sequence
Structure
        10           20        30        40        50        60
GAUGUGCGUUGCGGUUG---| C     C    A    C   AGA     U     UCCUUU 
                    CU GCGUA ACUC AUGG ACU   UGAAU CACGG      U
                    GG UGCGU UGAG UACC UGA   ACUUA GUGCC      U
UUUUCAUCAACAGUCGUAUC^ U     -    A    U   CC-     U     UUGUCG 
 .       110       100         90        80         70
Deep sequencing
Go to detailed chart
CommentThere are multiple Dicer sites on the 3p arm.
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-96-P3_5p

MirBase accessionMIMAT0021503
Sequence
0- AAUGGCACUAGAUGAAUUCACGG -23
Get sequence
Star sequence

Asu-Mir-96-P3_3p*

MirBase accessionMIMAT0021504
Sequence
39- GUGUAUUCACCAGUUCCAUAGA -61
Get sequence