MirGeneDB

MirGeneDB ID

Asu-Mir-87-o21

Family name MIR-87 (all species)
Seed UGAGCAA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-87b
Paralogues Asu-Mir-87-o20 
Orthologues Aae-Mir-87  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold299: 383882-383941 [-]
Precursor
(pre-Mir +30nt flank)
GUUGUGUAGAACAACGAAGAGAGUGCUCGACGCCUGGAACUUAGACUCAACCUCAGUGUAAUUGCGUAGGUGAGCAAAGUUUCAGGUGUUCGAGCGCCUUCUUUCGUUCGCACCUUCCCC
Get precursor sequence
Structure
        10         20         30        40        50        60
GUUGUGUAGAACAACGA-    A       -|            AGA    A   CAGUGU 
                  AGAG GUGCUCG ACGCCUGGAACUU   CUCA CCU      A
                  UCUU CGCGAGC UGUGGACUUUGAA   GAGU GGA      A
CCCCUUCCACGCUUGCUU    C       U^            AC-    -   UGCGUU 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-87-o21_5p*

MirBase accessionMIMAT0021483
Sequence
0- CGCCUGGAACUUAGACUCAACCU -23
Get sequence
Mature sequence

Asu-Mir-87-o21_3p

MirBase accessionMIMAT0021484
Sequence
39- GUGAGCAAAGUUUCAGGUGUU -60
Get sequence