MirGeneDB

MirGeneDB ID

Asu-Mir-87-o20

Family name MIR-87 (all species)
Seed UGAGCAA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-87a
Paralogues Asu-Mir-87-o21 
Orthologues Aae-Mir-87  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold253: 297752-297814 [-]
Precursor
(pre-Mir +30nt flank)
GCAUUGUGCGCGAAGCGGAUAUCCGCCACUCCGCCUGACACUAGGUCUCAACCUCUGUUGAUUUGAGCAGGUGAGCAAAGUCUCAGGUGUUGUGGCGGCCUUCAUCCAUCCUUCGCAGCCGUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCAUUGUGCGCGAAGCG---| UAU       UC       C   AG U    A   CUGUUG 
                    GA   CCGCCAC  CGCCUGA ACU  G CUCA CCU      A
                    CU   GGCGGUG  GUGGACU UGA  C GAGU GGA      U
UUGCCGACGCUUCCUACCUA^ UCC       UU       C   AA -    -   CGAGUU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-87-o20_5p*

MirBase accessionMIMAT0021481
Sequence
0- CCGCCUGACACUAGGUCUCAACCU -24
Get sequence
Mature sequence

Asu-Mir-87-o20_3p

MirBase accessionMIMAT0021482
Sequence
40- GUGAGCAAAGUCUCAGGUGUUGU -63
Get sequence