MirGeneDB

MirGeneDB ID

Asu-Mir-791

Family name MIR-791 (all species)
Seed UGGUCUG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-791
Paralogues
Orthologues Cbr-Mir-791  Cel-Mir-791 
Node of Origin (locus) Chromadorea
Node of Origin (family) Chromadorea
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold287: 265477-265534 [-]
Clustered MiRNAs
(< 10kb from Mir-791)
Mir-791 Scaffold287: 265477-265534 [-]
Mir-2-o59 Scaffold287: 267253-267310 [-]
Mir-2-P11 Scaffold287: 267429-267487 [-]
Mir-279-o28 Scaffold287: 267836-267891 [-]
Precursor
(pre-Mir +30nt flank)
GUGUCAUCUACGGGAAUGCUUGUUGGGGUGCUGGUCUGCUCCGUGUCCAAAGUUAUGUAUAGUCACUUUGGCACUCUCCAGGCCUGCACACUACAGCCUUUAACAAUUUCUCCCUGUC
Get precursor sequence
Structure
        10            20        30        40        50         
GUGUCAUCUACGGGAAU----|  U  U  G    U      CUCC   U       UAUGU 
                     GCU GU GG GUGC GGUCUG    GUG CCAAAGU     \
                     CGA CA UC CACG CCGGAC    CAC GGUUUCA     A
CUGUCCCUCUUUAACAAUUUC^  -  -  A    U      CUCU   -       CUGAU 
      110       100          90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-791_5p

MirBase accessionMIMAT0021529
Sequence
0- CUGGUCUGCUCCGUGUCCAAAGU -23
Get sequence
Co-mature sequence

Asu-Mir-791_3p

MirBase accessionMIMAT0021530
Sequence
36- UUUGGCACUCUCCAGGCCUGCA -58
Get sequence