MirGeneDB

MirGeneDB ID

Asu-Mir-76

Family name MIR-76 (all species)
Seed UCGUUGU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-76
Paralogues
Orthologues Aae-Mir-76  Bge-Mir-76  Cbr-Mir-76  Cel-Mir-76  Cgi-Mir-76  Cte-Mir-76  Dan-Mir-76  Dme-Mir-76  Dmo-Mir-76  Dpu-Mir-76  Efe-Mir-76  Hme-Mir-76  Isc-Mir-76  Lan-Mir-76-P1  Lan-Mir-76-P2  Lgi-Mir-76  Pmi-Mir-76  Spu-Mir-76  Tca-Mir-76 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold25: 1298666-1298724 [+]
Precursor
(pre-Mir +30nt flank)
AUUUCCCCCGCCUAGAUGGCCGCUGGCUGGUCGGGUUUUCUAUCAGCGAAUAUUUCGCUGAAAUUAUUCGUUGUUUAUGAAACCUGCUUAGCCGGUUGCCUUCUUUCCCCCUCCCCUUG
Get precursor sequence
Structure
        10          20        30        40         50        
AUUUCCCCCGCCUAGAU--   C         U        C  U-|        UUUCG 
                   GGC GCUGGCUGG CGGGUUUU UA  CAGCGAAUA     C
                   CCG UGGCCGAUU GUCCAAAG AU  GUUGCUUAU     U
GUUCCCCUCCCCCUUUCUU   U         C        U  UU^        UAAAG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-76_5p*

MirBase accessionMIMAT0021470
Sequence
0- UCGGGUUUUCUAUCAGCGAAUA -22
Get sequence
Mature sequence

Asu-Mir-76_3p

MirBase accessionMIMAT0021471
Sequence
36- UUCGUUGUUUAUGAAACCUGCUU -59
Get sequence