MirGeneDB

MirGeneDB ID

Asu-Mir-750

Family name MIR-750 (all species)
Seed CAGAUCU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-750
Paralogues
Orthologues Aae-Mir-750  Bge-Mir-750  Cgi-Mir-750  Cte-Mir-750  Dpu-Mir-750  Efe-Mir-750-P1  Efe-Mir-750-P2  Efe-Mir-750-P3  Hme-Mir-750  Isc-Mir-750  Lan-Mir-750  Lgi-Mir-750  Tca-Mir-750 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold33: 575078-575140 [+]
Clustered MiRNAs
(< 10kb from Mir-750)
Mir-750 Scaffold33: 575078-575140 [+]
Mir-1175 Scaffold33: 575559-575621 [+]
Precursor
(pre-Mir +30nt flank)
AGCAACAAUUUCAGUGGUCGAGUUUAUGGCAGUUGGAGGUUAGAUCUCGGGCAGAGCAUAUUCGGUUAUGCCAGAUCUAUUACUUCCAACUGACAUCGACUCGUCCUCAUUUAUUCCUCCUAC
Get precursor sequence
Structure
        10          20        30        40          50        60 
AGCAACAAUUUCAGUGGU--      U   G           --|      CG    GAGCAUA 
                    CGAGUU AUG CAGUUGGAGGU  UAGAUCU  GGCA       \
                    GCUCAG UAC GUCAACCUUCA  AUCUAGA  CCGU       U
CAUCCUCCUUAUUUACUCCU      C   A           UU^      --    AUUGGCU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-750_5p*

MirBase accessionMIMAT0021527
Sequence
0- AGUUGGAGGUUAGAUCUCGGGCA -23
Get sequence
Mature sequence

Asu-Mir-750_3p

MirBase accessionMIMAT0021528
Sequence
40- CCAGAUCUAUUACUUCCAACUGA -63
Get sequence