MirGeneDB

MirGeneDB ID

Asu-Mir-71

Family name MIR-71 (all species)
Seed GAAAGAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-71
Paralogues
Orthologues Aae-Mir-71  Bfl-Mir-71  Bge-Mir-71  Cbr-Mir-71  Cel-Mir-71  Cgi-Mir-71  Cte-Mir-71  Dpu-Mir-71  Efe-Mir-71-P1  Efe-Mir-71-P2  Efe-Mir-71-P3  Hme-Mir-71  Isc-Mir-71  Lan-Mir-71-P4  Lan-Mir-71-P5  Lgi-Mir-71  Pfl-Mir-71  Pmi-Mir-71  Sko-Mir-71  Spu-Mir-71  Tca-Mir-71 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold65: 284611-284668 [+]
Clustered MiRNAs
(< 10kb from Mir-71)
Mir-71 Scaffold65: 284611-284668 [+]
Mir-2-o58a Scaffold65: 285241-285298 [+]
Precursor
(pre-Mir +30nt flank)
GGCUAAUGUUGUGGACAGGCGGGAAUGUGGUGAAAGACAUGGGUAGUGAGACGUUACAUUGAGUCGUAUCACUAUUCUGUUUUUCGCCUCGUAUCCUCGCGCAGUCCCCCUCUUACUG
Get precursor sequence
Structure
        10        20          30        40        50         
GGCUAAUGUUGUGGACAG   -   -|  U           U         G   UUACA 
                  GCG GGA AUG GGUGAAAGACA GGGUAGUGA ACG     \
                  CGC CCU UGC CCGCUUUUUGU CUUAUCACU UGC     U
GUCAUUCUCCCCCUGACG   U   A^  U           -         A   UGAGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-71_5p

MirBase accessionMIMAT0021466
Sequence
0- UGAAAGACAUGGGUAGUGAGACG -23
Get sequence
Star sequence

Asu-Mir-71_3p*

MirBase accessionMIMAT0021467
Sequence
36- UAUCACUAUUCUGUUUUUCGCC -58
Get sequence