MirGeneDB

MirGeneDB ID

Asu-Mir-7

Family name MIR-7 (all species)
Seed GGAAGAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-7
Paralogues
Orthologues Aae-Mir-7  Aca-Mir-7-P1  Aca-Mir-7-P2  Aca-Mir-7-P3  Ami-Mir-7-P1  Ami-Mir-7-P2  Ami-Mir-7-P3  Ami-Mir-7-P4  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P1  Bta-Mir-7-P2  Bta-Mir-7-P3  Cfa-Mir-7-P1  Cfa-Mir-7-P2  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P1  Cli-Mir-7-P2  Cli-Mir-7-P3  Cli-Mir-7-P4  Cpi-Mir-7-P1  Cpi-Mir-7-P2  Cpi-Mir-7-P3  Cpi-Mir-7-P4  Cpo-Mir-7-P1  Cpo-Mir-7-P2  Cpo-Mir-7-P3  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P1  Dno-Mir-7-P2  Dno-Mir-7-P3  Dpu-Mir-7-P5  Dpu-Mir-7-P6  Dre-Mir-7-o1  Dre-Mir-7-P1  Dre-Mir-7-P2a  Dre-Mir-7-P2b  Efe-Mir-7-P7  Efe-Mir-7-P8  Efe-Mir-7-P9  Ete-Mir-7-P1  Ete-Mir-7-P2  Ete-Mir-7-P3  Gga-Mir-7-P1a  Gga-Mir-7-P1b  Gga-Mir-7-P2  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P1  Hsa-Mir-7-P2  Hsa-Mir-7-P3  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P1  Mdo-Mir-7-P2  Mdo-Mir-7-P3  Mml-Mir-7-P1  Mml-Mir-7-P2  Mml-Mir-7-P3  Mmu-Mir-7-P1  Mmu-Mir-7-P2  Mmu-Mir-7-P3  Oan-Mir-7-P1  Oan-Mir-7-P2  Ocu-Mir-7-P1  Ocu-Mir-7-P2  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P1  Rno-Mir-7-P2  Rno-Mir-7-P3  Sha-Mir-7-P1  Sha-Mir-7-P2  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P1  Sto-Mir-7-P2  Sto-Mir-7-P3  Tgu-Mir-7-P1  Tgu-Mir-7-P2c  Tgu-Mir-7-P2d  Tgu-Mir-7-P3  Xtr-Mir-7-P1  Xtr-Mir-7-P2  Xtr-Mir-7-P4 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold65: 653441-653501 [-]
Precursor
(pre-Mir +30nt flank)
ACGUGCAUACUAAAAAAGAGUACUCCCGGGUGGAAGACUGGUGAUUUUGUUGUUUGAGCUCAUCCAUAACAGCAAAUCCGUAGUCUCCACCUGGCAACUCCUAAGCUCCGAUCUUCCAGUA
Get precursor sequence
Structure
        10            20        30        40        50        60 
ACGUGCAUACUAAAAAA----|   ACUC         A     GU     U      UGAGCU 
                     GAGU    CCGGGUGGA GACUG  GAUUU GUUGUU      \
                     CUCA    GGUCCACCU CUGAU  CUAAA CGACAA      C
AUGACCUUCUAGCCUCGAAUC^   AC--         -     GC     -      UACCUA 
 .       110       100          90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-7_5p

MirBase accessionMIMAT0021429
Sequence
0- UGGAAGACUGGUGAUUUUGUUGUU -24
Get sequence
Star sequence

Asu-Mir-7_3p*

MirBase accessionMIMAT0021430
Sequence
39- CAGCAAAUCCGUAGUCUCCACC -61
Get sequence