MirGeneDB

MirGeneDB ID

Asu-Mir-54-o3

Family name MIR-54 (all species)
Seed CAUGUUG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5358b
Paralogues Asu-Mir-54-o1  Asu-Mir-54-o2 
Orthologues Cbr-Mir-54-P3  Cel-Mir-54-P3 
Node of Origin (locus) A. suum
Node of Origin (family) Chromadorea
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold882: 12067-12126 [+]
Clustered MiRNAs
(< 10kb from Mir-54-o3)
Mir-54-o2 Scaffold882: 8167-8228 [+]
Mir-54-o3 Scaffold882: 12067-12126 [+]
Precursor
(pre-Mir +30nt flank)
GCUCACAUCUGAAGGGUUUUGUGUCGGCAACCAUGUUGGUGCGUCGUGGUAUGCUGAUGGUGUAUUCAUACCCGUAAUGCCAACAUGCAUGCUUGCACUUCCCAGAAAAUUUGCUUGGUU
Get precursor sequence
Structure
        10        20          30        40        50          
GCUCACAUCUGAAGGGUUUU--|   C    AC          CGU  U      CUGAUG 
                      GUGU GGCA  CAUGUUGGUG   CG GGUAUG      \
                      CACG UCGU  GUACAACCGU   GC CCAUAC      G
UUGGUUCGUUUAAAAGACCCUU^   U    AC          AAU  -      UUAUGU 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-54-o3_5p

MirBase accessionMIMAT0021598
Sequence
0- CCAUGUUGGUGCGUCGUGGUAUG -23
Get sequence
Co-mature sequence

Asu-Mir-54-o3_3p

MirBase accessionMIMAT0021599
Sequence
38- UACCCGUAAUGCCAACAUGCAU -60
Get sequence