MirGeneDB

MirGeneDB ID

Asu-Mir-54-o2

Family name MIR-54 (all species)
Seed ACCCGUA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5358a
Paralogues Asu-Mir-54-o1  Asu-Mir-54-o3 
Orthologues Cbr-Mir-54-P2  Cel-Mir-54-P2 
Node of Origin (locus) A. suum
Node of Origin (family) Chromadorea
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold882: 8167-8228 [+]
Clustered MiRNAs
(< 10kb from Mir-54-o2)
Mir-54-o2 Scaffold882: 8167-8228 [+]
Mir-54-o3 Scaffold882: 12067-12126 [+]
Precursor
(pre-Mir +30nt flank)
GCGUUUUCAUUUUAUGAGGGGUGUGGGAGGCGGUUAUGGUAUUGCGCUGGUAUGUUGAUUCUGUGUUCAUACCCGUAAUUGCCAUGACUGUUUCCCGCUCCUCAACUGUGCCGCUUGCGUUG
Get precursor sequence
Structure
        10          20        30        40         50        60 
GCGUUUUCAUUUUAUGA--    U                  -|     CU      UUGAUU 
                   GGGG GUGGGAGGCGGUUAUGGU AUUGCG  GGUAUG      \
                   CUCC CGCCCUUUGUCAGUACCG UAAUGC  CCAUAC      C
GUUGCGUUCGCCGUGUCAA    U                  U^     --      UUGUGU 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-54-o2_5p*

MirBase accessionMIMAT0021578
Sequence
0- CGGUUAUGGUAUUGCGCUGGUAUG -24
Get sequence
Mature sequence

Asu-Mir-54-o2_3p

MirBase accessionMIMAT0021579
Sequence
39- UACCCGUAAUUGCCAUGACUGUU -62
Get sequence