MirGeneDB

MirGeneDB ID

Asu-Mir-54-o1

Family name MIR-54 (all species)
Seed ACCCGUA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-56
Paralogues Asu-Mir-54-o2  Asu-Mir-54-o3 
Orthologues Cbr-Mir-54-P1a  Cbr-Mir-54-P1b-v1  Cbr-Mir-54-P1b-v2  Cbr-Mir-54-P1c  Cel-Mir-54-P1 
Node of Origin (locus) A. suum
Node of Origin (family) Chromadorea
Genome context
(ASU_PRJNA80881_plustraces)
C4628901: 434-493 [+]
Precursor
(pre-Mir +30nt flank)
UUGUGCGAUGGGUGUGCGGUCGUCUGGAGCCGGGUGGCAGACUAUCUGGGUAUGUGCAUAUAUAUUCAUACCCGUAAGUCUCCAUCGAGCUCCGGCUGUCGGUUCGCCUACAUGUGCCUU
Get precursor sequence
Structure
        10           20        30        40        50        60
UUGUGCGAUGGGUGUGC---| U  U       CG     C     AUC        UGCAU 
                    GG CG CUGGAGC  GGUGG AGACU   UGGGUAUG     A
                    CU GU GGCCUCG  CUACC UCUGA   GCCCAUAC     U
UUCCGUGUACAUCCGCUUGG^ -  C       AG     -     AU-        UUAUA 
.       110       100         90         80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-54-o1_5p*

MirBase accessionNone
Sequence
0- CGGGUGGCAGACUAUCUGGGUAUG -24
Get sequence
Mature sequence

Asu-Mir-54-o1_3p

MirBase accessionMIMAT0021463
Sequence
38- UACCCGUAAGUCUCCAUCGAGC -60
Get sequence