MirGeneDB

MirGeneDB ID

Asu-Mir-5364

Family name MIR-5364 (all species)
Seed GAGGUAU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5364
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold392: 63851-63910 [-]
Precursor
(pre-Mir +30nt flank)
UGCGUCGUCGUUUCACGAGCGAAUGAACUCAGCUAAUGGACUUUACUUCCUCUGCUUAAUUUUUCUGCAGAGGUAUUGUUUAUUGGCUAAGAUCAAAGCUCGAGCCCGGCAGCUUCGAAG
Get precursor sequence
Structure
        10           20        30        40        50        60 
UGCGUCGUCGUUUCACG---|  GAA   A  C           UU  CUU       UUAAU 
                    AGC   UGA CU AGCUAAUGGAC  UA   CCUCUGC     \
                    UCG   ACU GA UCGGUUAUUUG  AU   GGAGACG     U
GAAGCUUCGACGGCCCGAGC^  AA-   A  A           UU  ---       UCUUU 
.       110       100         90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5364_5p*

MirBase accessionMIMAT0021590
Sequence
0- AGCUAAUGGACUUUACUUCCUCUGC -25
Get sequence
Mature sequence

Asu-Mir-5364_3p

MirBase accessionMIMAT0021591
Sequence
38- AGAGGUAUUGUUUAUUGGCUAA -60
Get sequence