MirGeneDB

MirGeneDB ID

Asu-Mir-5363

Family name MIR-5363 (all species)
Seed UGGGCAA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5363
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold89: 139857-139915 [-]
Precursor
(pre-Mir +30nt flank)
CACCCAUCGUCCAUAGCGAGUCGUACGCUGAUGGGCAAAGUUUCUGAACCGUGUUGUGUUCAAGGCUAAACGGUUUGGCACUUGCCCAGCACUGUAUGACCGAUUGCCUCGGUUUUGAA
Get precursor sequence
Structure
        10         20        30        40        50        60 
CACCCAUCGUCCAUAGC-|A        C  A       A  UU UG      GUUGUGUU 
                  G GUCGUACG UG UGGGCAA GU  C  AACCGU        \
                  C CAGUAUGU AC ACCCGUU CA  G  UUGGCA        C
AAGUUUUGGCUCCGUUAG^-        C  G       -  C- GU      AAUCGGAA 
       110        100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-5363_5p

MirBase accessionMIMAT0021588
Sequence
0- AUGGGCAAAGUUUCUGAACCGUGU -24
Get sequence
Star sequence

Asu-Mir-5363_3p*

MirBase accessionMIMAT0021589
Sequence
39- ACGGUUUGGCACUUGCCCAG -59
Get sequence