MirGeneDB

MirGeneDB ID

Asu-Mir-5359

Family name MIR-5359 (all species)
Seed CUGGGAU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5359
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold3: 295177-295234 [+]
Precursor
(pre-Mir +30nt flank)
CGAGAGCGUGAAAGAUGCGACAAUGUGUGGUCUGGGAUUGUCUAUAUUGGUAAAAGUGAAUGCAUACCAAUAUCCACAAUCCUUGAGCAGACAAAUGUCAUGCCGCUUUAUUACCGCG
Get precursor sequence
Structure
        10         20         30        40        50        
CGAGAGCGUGAAAGAUGC-    A-|  G  G  U        CU         AAAGU 
                   GACA  UGU UG UC GGGAUUGU  AUAUUGGUA     G
                   CUGU  ACA AC AG UCCUAACA  UAUAACCAU     A
GCGCCAUUAUUUCGCCGUA    AA^  G  G  U        CC         ACGUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-5359_5p

MirBase accessionMIMAT0021580
Sequence
0- UCUGGGAUUGUCUAUAUUGGUA -22
Get sequence
Star sequence

Asu-Mir-5359_3p*

MirBase accessionMIMAT0021581
Sequence
36- CCAAUAUCCACAAUCCUUGAGC -58
Get sequence