MirGeneDB

MirGeneDB ID

Asu-Mir-5353

Family name MIR-5353 (all species)
Seed CAUUGCG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5353
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold618: 101798-101858 [+]
Precursor
(pre-Mir +30nt flank)
UGGAUGAUCACAUACCAGACGCGCACCCUUAGGCGAACAGUGUGCAAUUCGAGUUGAUUAUUUGCAACUCAUUGCGAUUUUGUUCGGCUCAUGGUGUUCGACACCUGCCAUCUCAAGUUUU
Get precursor sequence
Structure
        10          20        30        40         50        60
UGGAUGAUCACAUACCAGA--  C     CUU  G       UG-|     UC    UGAUU 
                     CG GCACC   AG CGAACAG   UGCAAU  GAGU     A
                     GC UGUGG   UC GCUUGUU   GCGUUA  CUCA     U
UUUUGAACUCUACCGUCCACA  U     UAC  G       UUA^     --    ACGUU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5353_5p*

MirBase accessionMIMAT0021566
Sequence
0- AGGCGAACAGUGUGCAAUUCGAGU -24
Get sequence
Mature sequence

Asu-Mir-5353_3p

MirBase accessionMIMAT0021567
Sequence
38- UCAUUGCGAUUUUGUUCGGCUCA -61
Get sequence