MirGeneDB

MirGeneDB ID

Asu-Mir-34

Family name MIR-34 (all species)
Seed GGCAGUG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-34
Paralogues
Orthologues Aae-Mir-34  Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3c  Aca-Mir-34-P3d  Ami-Mir-34-P1  Ami-Mir-34-P2a  Ami-Mir-34-P2b  Ami-Mir-34-P3a  Ami-Mir-34-P3b  Ami-Mir-34-P3c  Ami-Mir-34-P3d  Bfl-Mir-34-P5a  Bfl-Mir-34-P5b  Bfl-Mir-34-P6  Bfl-Mir-34-P6a  Bfl-Mir-34-P6b  Bfl-Mir-34-P7a  Bfl-Mir-34-P7b  Bge-Mir-34  Bta-Mir-34-P1  Bta-Mir-34-P2a  Bta-Mir-34-P2b  Bta-Mir-34-P3a  Bta-Mir-34-P3b  Bta-Mir-34-P3c  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P1  Cfa-Mir-34-P2a-v1  Cfa-Mir-34-P2a-v2  Cfa-Mir-34-P2b  Cfa-Mir-34-P3a  Cfa-Mir-34-P3b  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P1  Cli-Mir-34-P2a  Cli-Mir-34-P2b  Cli-Mir-34-P3a  Cli-Mir-34-P3b  Cli-Mir-34-P3c  Cli-Mir-34-P3d  Cpi-Mir-34-P1  Cpi-Mir-34-P2a  Cpi-Mir-34-P2b  Cpi-Mir-34-P3a  Cpi-Mir-34-P3b  Cpi-Mir-34-P3c  Cpi-Mir-34-P3d  Cpo-Mir-34-P1  Cpo-Mir-34-P2a  Cpo-Mir-34-P2b  Cpo-Mir-34-P3a  Cpo-Mir-34-P3c  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P1  Dno-Mir-34-P2a  Dno-Mir-34-P2b  Dno-Mir-34-P3a  Dno-Mir-34-P3c  Dpu-Mir-34  Dre-Mir-34-P1  Dre-Mir-34-P2a  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P1  Ete-Mir-34-P2a  Ete-Mir-34-P2b  Ete-Mir-34-P3a  Ete-Mir-34-P3b  Gga-Mir-34-P1  Gga-Mir-34-P2a  Gga-Mir-34-P2b  Gga-Mir-34-P3a  Gga-Mir-34-P3b  Gga-Mir-34-P3c  Gga-Mir-34-P3d  Hme-Mir-34-P8a  Hme-Mir-34-P8b  Hsa-Mir-34-P1  Hsa-Mir-34-P2a  Hsa-Mir-34-P2b  Hsa-Mir-34-P3a  Hsa-Mir-34-P3b  Hsa-Mir-34-P3c  Lan-Mir-34-P8  Lan-Mir-34-P9  Lgi-Mir-34  Mdo-Mir-34-P1  Mdo-Mir-34-P2a  Mdo-Mir-34-P2b  Mdo-Mir-34-P3a  Mdo-Mir-34-P3b  Mdo-Mir-34-P3d  Mml-Mir-34-P1  Mml-Mir-34-P2a  Mml-Mir-34-P2b  Mml-Mir-34-P3a  Mml-Mir-34-P3b  Mmu-Mir-34-P1  Mmu-Mir-34-P2a  Mmu-Mir-34-P2b  Mmu-Mir-34-P3a  Mmu-Mir-34-P3b  Mmu-Mir-34-P3c  Oan-Mir-34-P1  Oan-Mir-34-P2a  Oan-Mir-34-P2b  Oan-Mir-34-P3a  Oan-Mir-34-P3b  Oan-Mir-34-P3c  Ocu-Mir-34-P1  Ocu-Mir-34-P2a  Ocu-Mir-34-P2b  Ocu-Mir-34-P3a  Ocu-Mir-34-P3b  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P1  Rno-Mir-34-P2a  Rno-Mir-34-P2b  Rno-Mir-34-P3a  Rno-Mir-34-P3b  Rno-Mir-34-P3c  Sha-Mir-34-P1  Sha-Mir-34-P2a  Sha-Mir-34-P2b  Sha-Mir-34-P3a  Sha-Mir-34-P3b  Sha-Mir-34-P3d  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P1  Sto-Mir-34-P2a  Sto-Mir-34-P2b  Sto-Mir-34-P3a  Sto-Mir-34-P3c  Sto-Mir-34-P3d  Tca-Mir-34  Tgu-Mir-34-P1  Tgu-Mir-34-P2a5  Tgu-Mir-34-P2a6  Tgu-Mir-34-P2b  Tgu-Mir-34-P3a  Tgu-Mir-34-P3c  Tgu-Mir-34-P3d  Xtr-Mir-34-P1  Xtr-Mir-34-P2a1  Xtr-Mir-34-P2a2  Xtr-Mir-34-P2a3  Xtr-Mir-34-P2a4  Xtr-Mir-34-P2b  Xtr-Mir-34-P3a  Xtr-Mir-34-P3b  Xtr-Mir-34-P3c 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold465: 69571-69628 [-]
Precursor
(pre-Mir +30nt flank)
GACGAUUUGCCAAGCGGAUAAGUCACCGGCUGGCAGUGUGGUUAGCUGGUUGUCAGAUGUGAGACAACGGCUAUCACCACUGCCGUCCUGGUGGUUCGUCCAUCCGUCAUCUUCGAUA
Get precursor sequence
Structure
        10          20         30         40        50        
GACGAUUUGCCAAGCGG-- UA GU    -  C       -|    U     G    CAGA 
                   A  A  CACC GG UGGCAGU GUGGU AGCUG UUGU    U
                   U  U  GUGG CC GCCGUCA CACUA UCGGC AACA    G
AUAGCUUCUACUGCCUACC GC UG    U  U       C^    -     -    GAGU 
      110       100        90        80         70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-34_5p

MirBase accessionMIMAT0021437
Sequence
0- UGGCAGUGUGGUUAGCUGGUUGU -23
Get sequence
Star sequence

Asu-Mir-34_3p*

MirBase accessionMIMAT0021438
Sequence
35- AACGGCUAUCACCACUGCCGUCC -58
Get sequence