MirGeneDB

MirGeneDB ID

Asu-Mir-305

Family name MIR-305 (all species)
Seed UUGUACU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-239
Paralogues
Orthologues Aae-Mir-305  Bge-Mir-305  Cbr-Mir-305-P1  Cbr-Mir-305-P2  Cbr-Mir-305-P3  Cel-Mir-305-P1  Cel-Mir-305-P2  Dan-Mir-305  Dme-Mir-305  Dmo-Mir-305  Dpu-Mir-305  Hme-Mir-305  Isc-Mir-305  Tca-Mir-305 
Node of Origin (locus) Ecdysozoa
Node of Origin (family) Ecdysozoa
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold465: 140784-140842 [+]
Precursor
(pre-Mir +30nt flank)
UGGGUGUGGUUGAUUGCCAGCUUGUUGAACUUUGUACUUCGGCUAAGGUGCUGCUCUAUGGCGGCCAGUACCUUGGCUAGGUGCAACGCUGAAUAGUUGGCUUCGAUAGUGAUGCGGCG
Get precursor sequence
Structure
        10           20        30        40        50         
UGGGUGUGGUUGAUUGC---|    UGUUGAACU        C             CUCUA 
                    CAGCU         UUGUACUU GGCUAAGGUGCUG     U
                    GUUGA         AACGUGGA UCGGUUCCAUGAC     G
GCGGCGUAGUGAUAGCUUCG^    UAAGUCGC-        -             CGGCG 
       110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-305_5p

MirBase accessionMIMAT0021521
Sequence
0- UUUGUACUUCGGCUAAGGUGCUG -23
Get sequence
Star sequence

Asu-Mir-305_3p*

MirBase accessionMIMAT0021522
Sequence
38- UACCUUGGCUAGGUGCAACGC -59
Get sequence