MirGeneDB

MirGeneDB ID

Asu-Mir-279-o30

Family name MIR-279 (all species)
Seed GACUAGA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-279c
Paralogues Asu-Mir-279-o26  Asu-Mir-279-o27  Asu-Mir-279-o28  Asu-Mir-279-o29 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold919: 52254-52311 [+]
Clustered MiRNAs
(< 10kb from Mir-279-o30)
Mir-2-o62b Scaffold919: 52009-52066 [+]
Mir-279-o30 Scaffold919: 52254-52311 [+]
Precursor
(pre-Mir +30nt flank)
CAUUGUGUCCUCUUACUGGGCGUCACUGGAGCUGGCUUACCGUCUAGUGCAUGUAAUGUGAAAUCAUGACUAGACUGGUAACCUGCUCUAGUUUCGUUCCUUUAGUUCCCUCCAGUGU
Get precursor sequence
Structure
        10          20        30        40         50         
CAUUGUGUCCUCUUACU--|    UC        U  C     -       G    UAAUG 
                   GGGCG  ACUGGAGC GG UUACC GUCUAGU CAUG     \
                   CUUGC  UGAUCUCG CC AAUGG CAGAUCA GUAC     U
UGUGACCUCCCUUGAUUUC^    UU        U  -     U       -    UAAAG 
      110       100        90         80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-279-o30_5p* (predicted)

MirBase accessionMIMAT0021515
Sequence
0- GCUGGCUUACCGUCUAGUGCAUG -23
Get sequence
Mature sequence

Asu-Mir-279-o30_3p

MirBase accessionMIMAT0021516
Sequence
36- UGACUAGACUGGUAACCUGCUC -58
Get sequence