MirGeneDB

MirGeneDB ID

Asu-Mir-279-o29

Family name MIR-279 (all species)
Seed GACUAGA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-279b
Paralogues Asu-Mir-279-o26  Asu-Mir-279-o27  Asu-Mir-279-o28  Asu-Mir-279-o30 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold1765: 14642-14699 [+]
Clustered MiRNAs
(< 10kb from Mir-279-o29)
Mir-2-o62a Scaffold1765: 14467-14524 [+]
Mir-279-o29 Scaffold1765: 14642-14699 [+]
Mir-2-o62d Scaffold1765: 14913-14972 [+]
Precursor
(pre-Mir +30nt flank)
UGUUGUGUCUCCUUAUUCGGCGUCACUGGAACUGGUUUGCAGUCUAGUGCAUGCAAUAUGAAGUCAUGACUAGACUGAUAACCAGCUCUAGUUUCGUUCCUCUAGUUCCCACCAGUGU
Get precursor sequence
Structure
        10          20        30        40        50         
UGUUGUGUCUCCUUAUUC--|   UC      A      UG         G    CAAUA 
                    GGCG  ACUGGA CUGGUU  CAGUCUAGU CAUG     \
                    UUGC  UGAUCU GACCAA  GUCAGAUCA GUAC     U
UGUGACCACCCUUGAUCUCC^   UU      C      UA         -    UGAAG 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-279-o29_5p*

MirBase accessionMIMAT0021513
Sequence
0- ACUGGUUUGCAGUCUAGUGCAUG -23
Get sequence
Mature sequence

Asu-Mir-279-o29_3p

MirBase accessionMIMAT0021514
Sequence
36- UGACUAGACUGAUAACCAGCUC -58
Get sequence